===============================
fuzzysearch
===============================
.. image:: https://badge.fury.io/py/fuzzysearch.png
:target: http://badge.fury.io/py/fuzzysearch
.. image:: https://travis-ci.org/taleinat/fuzzysearch.png?branch=master
:target: https://travis-ci.org/taleinat/fuzzysearch
.. image:: https://coveralls.io/repos/taleinat/fuzzysearch/badge.png
:target: https://coveralls.io/r/taleinat/fuzzysearch
.. image:: https://pypip.in/d/fuzzysearch/badge.png
:target: https://crate.io/packages/fuzzysearch?version=latest
fuzzysearch is useful for finding approximate subsequence matches
* Free software: MIT license
* Documentation: http://fuzzysearch.rtfd.org.
Features
--------
* Fuzzy sub-sequence search: Find parts of a sequence which match a given
sub-sequence up to a given maximum Levenshtein distance.
* Set individual limits for the number of substitutions, insertions and/or
deletions allowed for a near-match.
* Includes optimized implementations for specific use-cases, e.g. only allowing
substitutions in near-matches.
Simple Example
--------------
You can usually just use the `find_near_matches()` utility function, which
chooses a suitable fuzzy search implementation according to the given
parameters:
.. code:: python
>>> from fuzzysearch import find_near_matches
>>> find_near_matches('PATTERN', 'aaaPATERNaaa', max_l_dist=1)
[Match(start=3, end=9, dist=1)]
Advanced Example
----------------
If needed you can choose a specific search implementation, such as
`find_near_matches_with_ngrams()`:
.. code:: python
>>> sequence = '''\
GACTAGCACTGTAGGGATAACAATTTCACACAGGTGGACAATTACATTGAAAATCACAGATTGGTCACACACACA
TTGGACATACATAGAAACACACACACATACATTAGATACGAACATAGAAACACACATTAGACGCGTACATAGACA
CAAACACATTGACAGGCAGTTCAGATGATGACGCCCGACTGATACTCGCGTAGTCGTGGGAGGCAAGGCACACAG
GGGATAGG'''
>>> subsequence = 'TGCACTGTAGGGATAACAAT' #distance 1
>>> max_distance = 2
>>> from fuzzysearch import find_near_matches_with_ngrams
>>> find_near_matches_with_ngrams(subsequence, sequence, max_distance)
[Match(start=3, end=24, dist=1)]