diff --git a/docs/project/changelog.md b/docs/project/changelog.md
index 173646a62..d651b63c6 100644
--- a/docs/project/changelog.md
+++ b/docs/project/changelog.md
@@ -26,6 +26,11 @@ myst:
   a single file.
   {pr}`3727`
 
+### Packages
+
+- New packages: sourmash {pr}`3635`, screed {pr}`3635`, bitstring {pr}`3635`,
+  deprecation {pr}`3635`, cachetools {pr}`3635`.
+
 ## Version 0.23.0
 
 _March 30, 2023_
diff --git a/packages/bitstring/meta.yaml b/packages/bitstring/meta.yaml
new file mode 100644
index 000000000..0fd70091b
--- /dev/null
+++ b/packages/bitstring/meta.yaml
@@ -0,0 +1,13 @@
+package:
+  name: bitstring
+  version: 4.0.1
+  top-level:
+    - bitstring
+source:
+  url: https://files.pythonhosted.org/packages/1b/07/951d7bc9804fcec26e8cdbf1d352018a21c16194d42e3f38cb7f5564ca4b/bitstring-4.0.1-py3-none-any.whl
+  sha256: 4a27cdefd95eb535c4b79e0afcdb5532ba1dba0aaed98a31ad98f46b1e0d5bd9
+about:
+  home: ""
+  PyPI: https://pypi.org/project/bitstring
+  summary: Simple construction, analysis and modification of binary data.
+  license: ""
diff --git a/packages/cachetools/meta.yaml b/packages/cachetools/meta.yaml
new file mode 100644
index 000000000..988b85e59
--- /dev/null
+++ b/packages/cachetools/meta.yaml
@@ -0,0 +1,13 @@
+package:
+  name: cachetools
+  version: 5.3.0
+  top-level:
+    - cachetools
+source:
+  url: https://files.pythonhosted.org/packages/db/14/2b48a834d349eee94677e8702ea2ef98b7c674b090153ea8d3f6a788584e/cachetools-5.3.0-py3-none-any.whl
+  sha256: 429e1a1e845c008ea6c85aa35d4b98b65d6a9763eeef3e37e92728a12d1de9d4
+about:
+  home: https://github.com/tkem/cachetools/
+  PyPI: https://pypi.org/project/cachetools
+  summary: Extensible memoizing collections and decorators
+  license: MIT
diff --git a/packages/deprecation/meta.yaml b/packages/deprecation/meta.yaml
new file mode 100644
index 000000000..e5e7b63cd
--- /dev/null
+++ b/packages/deprecation/meta.yaml
@@ -0,0 +1,16 @@
+package:
+  name: deprecation
+  version: 2.1.0
+  top-level:
+    - deprecation
+requirements:
+  run:
+    - packaging
+source:
+  url: https://files.pythonhosted.org/packages/02/c3/253a89ee03fc9b9682f1541728eb66db7db22148cd94f89ab22528cd1e1b/deprecation-2.1.0-py2.py3-none-any.whl
+  sha256: a10811591210e1fb0e768a8c25517cabeabcba6f0bf96564f8ff45189f90b14a
+about:
+  home: http://deprecation.readthedocs.io/
+  PyPI: https://pypi.org/project/deprecation
+  summary: A library to handle automated deprecations
+  license: Apache 2
diff --git a/packages/screed/meta.yaml b/packages/screed/meta.yaml
new file mode 100644
index 000000000..de29570a5
--- /dev/null
+++ b/packages/screed/meta.yaml
@@ -0,0 +1,14 @@
+package:
+  name: screed
+  version: 1.1.2
+  top-level:
+    - bigtests
+    - screed
+source:
+  url: https://files.pythonhosted.org/packages/a6/c1/e33d75369bffaf304b891afa34aa8b9765f117931673cdf8837eba9b0efb/screed-1.1.2-py2.py3-none-any.whl
+  sha256: 413e9cfce4b4908d0fa1fe69dcd2c523641a02a856eb196f9ce2183657f342dc
+about:
+  home: https://github.com/dib-lab/screed
+  PyPI: https://pypi.org/project/screed
+  summary: a Python library for loading FASTA and FASTQ sequences
+  license: BSD 3-clause
diff --git a/packages/sourmash/meta.yaml b/packages/sourmash/meta.yaml
new file mode 100644
index 000000000..191904d08
--- /dev/null
+++ b/packages/sourmash/meta.yaml
@@ -0,0 +1,28 @@
+package:
+  name: sourmash
+  version: 4.8.0
+  top-level:
+    - sourmash
+requirements:
+  run:
+    - screed
+    - cffi
+    - deprecation
+    - cachetools
+    - numpy
+    - matplotlib
+    - scipy
+    - sqlite3
+    - bitstring
+source:
+  url: https://pypi.io/packages/source/s/sourmash/sourmash-4.8.0.tar.gz
+  sha256: 778d5d182f9e625ae560a5b3a2fdf6bd4fd3b876c84593da8c8c07d11ce2c697
+build:
+  script: |
+    rustup toolchain install ${RUST_TOOLCHAIN} && rustup default ${RUST_TOOLCHAIN}
+    rustup target add wasm32-unknown-emscripten --toolchain ${RUST_TOOLCHAIN}
+about:
+  home: https://github.com/sourmash-bio/sourmash
+  PyPI: https://pypi.org/project/sourmash
+  summary: Compute and compare MinHash signatures for DNA data sets.
+  license: BSD-3-Clause
diff --git a/packages/sourmash/test_sourmash.py b/packages/sourmash/test_sourmash.py
new file mode 100644
index 000000000..24b7226e9
--- /dev/null
+++ b/packages/sourmash/test_sourmash.py
@@ -0,0 +1,23 @@
+import pytest
+from pytest_pyodide import run_in_pyodide
+
+
+@pytest.mark.driver_timeout(60)
+@run_in_pyodide(packages=["sourmash"])
+def test_simple_save_load(selenium):
+    from pathlib import Path
+    from tempfile import TemporaryDirectory
+
+    import sourmash
+
+    mh = sourmash.MinHash(0, 5, scaled=1)
+    mh.add_sequence("ACGTAGGTATAGGATACCTCGCTAGTACGTGCA")
+    ss = sourmash.SourmashSignature(mh, name="foo")
+
+    with TemporaryDirectory() as td:
+        name = Path(td) / "test.sig"
+        with open(name, "w") as fp:
+            sourmash.save_signatures([ss], fp=fp)
+
+        loaded = sourmash.load_one_signature(str(name))
+        assert loaded == ss